primer antisense mix (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
97
Structured Review
New England Biolabs
primer antisense mix
Primer Antisense Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1636 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+antisense+mix/Random+Primer+Mix/pm40062677-82-22-38
Average 97 stars, based on 1636 article reviews
Primer Antisense Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1636 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primer+antisense+mix/Random+Primer+Mix/pm40062677-82-22-38
Average 97 stars, based on 1636 article reviews
primer antisense mix - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Polymerase Chain Reaction:Article Title: The association of the FOXE1 polyalanine tract length with the occurrence of premature ovarian insufficiency in the Greek population: A pilot, case-control study. Article Snippet: All primers were designed by Eurofins Genomics and their sequences were as follows: FOXE1F, 5’GCGGAGGACATGTTCGAGA3’ and FOXE1R, 5’CGCGGGGTAGTAGACTGGAG3’. .. The PCR protocol included 10X PCR Buffer minus Mg2+, 0.5 μL 10 mM dNTP mixture, 0.5 μL Primer Sense mix, 0.5 μL Primer Antisense mix, 2 μL Template DNA, 0.2 μL Taq DNA polymerase ( Article Title: The association of the FOXE1 polyalanine tract length with the occurrence of premature ovarian insufficiency in the Greek population: A pilot, case-control study Article Snippet: All primers were designed by Eurofins Genomics and their sequences were as follows: FOXE1F, 5’GCGGAGGACATGTTCGAGA3’ and FOXE1R, 5’CGCGGGGTAGTAGACTGGAG3’. .. The PCR protocol included 10X PCR Buffer minus Mg2+, 0.5 μL 10 mM dNTP mixture, 0.5 μL Primer Sense mix, 0.5 μL Primer Antisense mix, 2 μL Template DNA, 0.2 μL Taq DNA polymerase ( |